Symbol:
Kcnma1
Name:
potassium calcium-activated channel subfamily M alpha 1
RGD ID:
620715
Description:
Enables identical protein binding activity and monoatomic ion channel activity. Involved in several processes, including negative regulation of small intestine smooth muscle contraction; positive regulation of neuron apoptotic process; and response to estrogen. Located in several cellular components, including external side of plasma membrane; neuronal cell body; and perinuclear region of cytoplasm. Part of protein-containing complex. Is active in glutamatergic synapse and presynaptic active zone membrane. Human ortholog(s) of this gene implicated in Alzheimer's disease; generalized epilepsy; and paroxysmal nonkinesigenic dyskinesia 3. Orthologous to human KCNMA1 (potassium calcium-activated channel subfamily M alpha 1); INTERACTS WITH (+)-pilocarpine; (+)-Pimaric acid; (R)-noradrenaline.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
BK channel; BKCa; BKCA alpha; calcium-activated potassium channel alpha subunit; calcium-activated potassium channel subunit alpha-1; calcium-activated potassium channel, subfamily M subunit alpha-1; cbv1; k(VCA)alpha; KCa1.1; Kcnma; KCNMA1b; KCNMA1c; LOC498438; maxi K channel; maxiK; potassium channel, calcium activated large conductance subfamily M alpha, member 1; potassium large conductance calcium-activated channel, subfamily M, alpha member 1; similar to potassium large conductance calcium-activated channel, subfamily M, alpha member 1; Slo; slo homolog; slo-alpha; slo1; slowpoke homolog
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, OMA, OrthoDB, Panther
Mus musculus (house mouse):
Kcnma1 (potassium large conductance calcium-activated channel, subfamily M, alpha member 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Kcnma1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Kcnma1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Kcnma1 (potassium calcium-activated channel subfamily M alpha 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
ZNF648 (zinc finger protein 648) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
KCNMA1 (potassium calcium-activated channel subfamily M alpha 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Kcnma1 (potassium large conductance calcium-activated channel, subfamily M, alpha member 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
kcnma1b (potassium large conductance calcium-activated channel, subfamily M, alpha member 1b)
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PhylomeDB)
Danio rerio (zebrafish):
kcnma1a (potassium large conductance calcium-activated channel, subfamily M, alpha member 1a)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
slo-1
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
slo
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
kcnma1
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Allele / Splice:
Kcnma1_v1
Kcnma1_v2
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 351,065 - 1,057,117 (+) NCBI GRCr8 mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 302,214 - 1,001,198 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 309,515 - 1,014,692 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 1,696,105 - 2,401,327 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 308,241 - 1,013,437 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 344,204 - 1,048,849 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 344,360 - 1,047,956 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 339,100 - 1,037,105 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 575,136 - 950,275 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 322,288 - 950,273 NCBI Celera 15 3,556,267 - 4,246,392 (-) NCBI Celera Cytogenetic Map 15 p16 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Kcnma1 Rat (+)-pilocarpine decreases expression EXP 6480464 Pilocarpine results in decreased expression of KCNMA1 mRNA CTD PMID:18695509 Kcnma1 Rat (+)-Pimaric acid affects response to substance EXP 6480464 KCNMA1 mRNA affects the susceptibility to pimaric acid CTD PMID:19247476 Kcnma1 Rat (R)-noradrenaline affects response to substance EXP 6480464 KCNMA1 protein affects the susceptibility to Norepinephrine CTD PMID:22226998 Kcnma1 Rat 1,2-dichloroethane increases expression ISO Kcnma1 (Mus musculus) 6480464 ethylene dichloride results in increased expression of KCNMA1 mRNA CTD PMID:28189721 and PMID:28960355 Kcnma1 Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of KCNMA1 mRNA CTD PMID:17557909 Kcnma1 Rat 17beta-estradiol increases activity ISO KCNMA1 (Homo sapiens) 6480464 Estradiol results in increased activity of KCNMA1 protein CTD PMID:18068743 Kcnma1 Rat 17beta-estradiol multiple interactions EXP 6480464 Fulvestrant inhibits the reaction [Estradiol results in decreased expression of KCNMA1 mRNA alternative form] more ... CTD PMID:16102753 Kcnma1 Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of KCNMA1 mRNA more ... CTD PMID:16102753 Kcnma1 Rat 17beta-estradiol multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of KCNMA1 mRNA more ... CTD PMID:18068743 more ... Kcnma1 Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO KCNMA1 (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of KCNMA1 mRNA CTD PMID:29581250 Kcnma1 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Kcnma1 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Kcnma1 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Kcnma1 Rat 2,4-D multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:37567420 Kcnma1 Rat 2-bromohexadecanoic acid multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of KCNMA1 protein] CTD PMID:38195004 Kcnma1 Rat 2-methylcholine affects expression ISO KCNMA1 (Homo sapiens) 6480464 beta-methylcholine affects the expression of KCNMA1 mRNA CTD PMID:21179406 Kcnma1 Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO KCNMA1 (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of KCNMA1 mRNA CTD PMID:35321852 Kcnma1 Rat 3,3',5-triiodo-L-thyronine multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 mRNA and [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 protein CTD PMID:27605626 Kcnma1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 mRNA and [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 protein CTD PMID:27605626 Kcnma1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of KCNMA1 mRNA CTD PMID:28628672 Kcnma1 Rat 4,4'-sulfonyldiphenol increases expression ISO Kcnma1 (Mus musculus) 6480464 bisphenol S results in increased expression of KCNMA1 mRNA CTD PMID:31881267 Kcnma1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of KCNMA1 mRNA CTD PMID:24780913 Kcnma1 Rat acetylcholine affects response to substance EXP 6480464 KCNMA1 protein affects the susceptibility to Acetylcholine CTD PMID:22226998 Kcnma1 Rat acrylamide decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Acrylamide results in decreased expression of KCNMA1 mRNA CTD PMID:35690182 Kcnma1 Rat aflatoxin B1 increases expression ISO Kcnma1 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of KCNMA1 mRNA CTD PMID:19770486 Kcnma1 Rat aflatoxin B1 decreases methylation ISO KCNMA1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of KCNMA1 exon CTD PMID:30157460 Kcnma1 Rat aflatoxin B1 affects methylation ISO KCNMA1 (Homo sapiens) 6480464 Aflatoxin B1 affects the methylation of KCNMA1 intron CTD PMID:30157460 Kcnma1 Rat aflatoxin B1 decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of KCNMA1 mRNA CTD PMID:31555880 more ... Kcnma1 Rat Aflatoxin B2 alpha affects methylation ISO KCNMA1 (Homo sapiens) 6480464 aflatoxin B2 affects the methylation of KCNMA1 intron CTD PMID:30157460 Kcnma1 Rat aldehydo-D-glucose multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 Glucose inhibits the reaction [[KCNMA1 protein binds to KCNMB1 protein] which results in decreased expression of BCL2 protein] more ... CTD PMID:21413024 Kcnma1 Rat aldehydo-D-glucose multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:37567420 Kcnma1 Rat all-trans-retinoic acid decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of KCNMA1 mRNA CTD PMID:23724009 Kcnma1 Rat alpha-Zearalanol decreases expression EXP 6480464 Zeranol results in decreased expression of KCNMA1 mRNA CTD PMID:35163327 Kcnma1 Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of KCNMA1 mRNA CTD PMID:35163327 Kcnma1 Rat amiodarone increases expression ISO KCNMA1 (Homo sapiens) 6480464 Amiodarone results in increased expression of KCNMA1 mRNA CTD PMID:19774075 Kcnma1 Rat aristolochic acid A decreases expression ISO KCNMA1 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of KCNMA1 mRNA CTD PMID:33212167 Kcnma1 Rat arsane affects methylation ISO KCNMA1 (Homo sapiens) 6480464 Arsenic affects the methylation of KCNMA1 gene CTD PMID:25304211 Kcnma1 Rat arsane multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat arsenic atom affects methylation ISO KCNMA1 (Homo sapiens) 6480464 Arsenic affects the methylation of KCNMA1 gene CTD PMID:25304211 Kcnma1 Rat arsenic atom multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat arsenous acid increases expression ISO KCNMA1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of KCNMA1 mRNA CTD PMID:20458559 Kcnma1 Rat benzo[a]pyrene decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of KCNMA1 mRNA CTD PMID:20064835 more ... Kcnma1 Rat benzo[a]pyrene affects methylation ISO KCNMA1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of KCNMA1 intron and Benzo(a)pyrene affects the methylation of KCNMA1 promoter CTD PMID:27901495 and PMID:30157460 Kcnma1 Rat benzo[a]pyrene decreases methylation ISO Kcnma1 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased methylation of KCNMA1 intron CTD PMID:27901495 Kcnma1 Rat benzo[a]pyrene increases methylation ISO KCNMA1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of KCNMA1 3' UTR and Benzo(a)pyrene results in increased methylation of KCNMA1 exon CTD PMID:27901495 Kcnma1 Rat benzo[a]pyrene increases expression ISO Kcnma1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of KCNMA1 mRNA CTD PMID:22228805 Kcnma1 Rat benzo[e]pyrene affects methylation ISO KCNMA1 (Homo sapiens) 6480464 benzo(e)pyrene affects the methylation of KCNMA1 intron CTD PMID:30157460 Kcnma1 Rat bexarotene multiple interactions EXP 6480464 [bexarotene co-treated with Tamoxifen] results in decreased expression of KCNMA1 mRNA CTD PMID:17630414 Kcnma1 Rat bis(2-chloroethyl) sulfide decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Mustard Gas results in decreased expression of KCNMA1 mRNA CTD PMID:25102026 Kcnma1 Rat bis(2-ethylhexyl) phthalate decreases expression EXP 6480464 Diethylhexyl Phthalate results in decreased expression of KCNMA1 mRNA CTD PMID:20920545 Kcnma1 Rat bis(2-ethylhexyl) phthalate increases expression ISO KCNMA1 (Homo sapiens) 6480464 Diethylhexyl Phthalate results in increased expression of KCNMA1 mRNA CTD PMID:31163220 Kcnma1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of KCNMA1 mRNA CTD PMID:25181051 and PMID:30816183 Kcnma1 Rat bisphenol A decreases methylation ISO KCNMA1 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of KCNMA1 gene CTD PMID:31601247 Kcnma1 Rat bisphenol A multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of KCNMA1 gene CTD PMID:31601247 Kcnma1 Rat bisphenol A decreases expression ISO KCNMA1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of KCNMA1 mRNA CTD PMID:36385337 Kcnma1 Rat bisphenol A decreases expression ISO Kcnma1 (Mus musculus) 6480464 bisphenol A results in decreased expression of KCNMA1 mRNA CTD PMID:31250031 and PMID:32156529 Kcnma1 Rat bisphenol A multiple interactions ISO Kcnma1 (Mus musculus) 6480464 ESR2 protein affects the reaction [bisphenol A results in decreased expression of KCNMA1 mRNA] CTD PMID:31250031 Kcnma1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of KCNMA1 gene CTD PMID:28505145 Kcnma1 Rat buta-1,3-diene decreases expression ISO Kcnma1 (Mus musculus) 6480464 1 and 3-butadiene results in decreased expression of KCNMA1 mRNA CTD PMID:29038090 Kcnma1 Rat cadmium atom multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of KCNMA1 protein] and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of KCNMA1 protein CTD PMID:38195004 Kcnma1 Rat cadmium dichloride decreases methylation EXP 6480464 Cadmium Chloride results in decreased methylation of KCNMA1 promoter CTD PMID:22457795 Kcnma1 Rat cadmium dichloride multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of KCNMA1 protein] and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of KCNMA1 protein CTD PMID:38195004 Kcnma1 Rat cadmium dichloride increases expression ISO KCNMA1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of KCNMA1 mRNA CTD PMID:38382870 and PMID:38568856 Kcnma1 Rat caesium atom affects activity ISO Kcnma1 (Mus musculus) 6480464 Cesium affects the activity of KCNMA1 protein CTD PMID:16636204 Kcnma1 Rat calcium atom increases response to substance EXP 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Calcium CTD PMID:28090300 Kcnma1 Rat calcium atom increases response to substance ISO KCNMA1 (Homo sapiens) 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Calcium CTD PMID:28090300 Kcnma1 Rat calcium atom multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [KCNMB1 protein co-treated with KCNMA1 protein] results in increased transport of Calcium and Lithocholic Acid promotes the reaction [[KCNMB1 protein co-treated with KCNMA1 protein] results in increased transport of Calcium] CTD PMID:22123969 Kcnma1 Rat calcium(0) multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [KCNMB1 protein co-treated with KCNMA1 protein] results in increased transport of Calcium and Lithocholic Acid promotes the reaction [[KCNMB1 protein co-treated with KCNMA1 protein] results in increased transport of Calcium] CTD PMID:22123969 Kcnma1 Rat calcium(0) increases response to substance EXP 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Calcium CTD PMID:28090300 Kcnma1 Rat calcium(0) increases response to substance ISO KCNMA1 (Homo sapiens) 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Calcium CTD PMID:28090300 Kcnma1 Rat CGP 52608 multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to KCNMA1 gene] CTD PMID:28238834 Kcnma1 Rat chlordecone affects expression ISO Kcnma1 (Mus musculus) 6480464 Chlordecone affects the expression of KCNMA1 mRNA CTD PMID:33711761 Kcnma1 Rat cisplatin multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [Piroxicam co-treated with Cisplatin] results in increased expression of KCNMA1 mRNA more ... CTD PMID:21858171 and PMID:27392435 Kcnma1 Rat cisplatin decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of KCNMA1 mRNA CTD PMID:19561079 and PMID:27392435 Kcnma1 Rat clothianidin decreases expression ISO KCNMA1 (Homo sapiens) 6480464 clothianidin results in decreased expression of KCNMA1 mRNA CTD PMID:31626844 and PMID:35690182 Kcnma1 Rat copper atom increases expression EXP 6480464 Copper deficiency results in increased expression of KCNMA1 mRNA CTD PMID:26033743 Kcnma1 Rat copper atom multiple interactions EXP 6480464 [Copper co-treated with Dietary Sucrose] results in increased expression of KCNMA1 mRNA CTD PMID:26033743 Kcnma1 Rat copper(0) increases expression EXP 6480464 Copper deficiency results in increased expression of KCNMA1 mRNA CTD PMID:26033743 Kcnma1 Rat copper(0) multiple interactions EXP 6480464 [Copper co-treated with Dietary Sucrose] results in increased expression of KCNMA1 mRNA CTD PMID:26033743 Kcnma1 Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of KCNMA1 mRNA CTD PMID:26577399 Kcnma1 Rat D-glucose multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 Glucose inhibits the reaction [[KCNMA1 protein binds to KCNMB1 protein] which results in decreased expression of BCL2 protein] more ... CTD PMID:21413024 Kcnma1 Rat D-glucose multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:37567420 Kcnma1 Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of KCNMA1 mRNA CTD PMID:23914054 Kcnma1 Rat dexamethasone multiple interactions EXP 6480464 Dexamethasone inhibits the reaction [nitrofen results in decreased expression of KCNMA1 mRNA] and Dexamethasone inhibits the reaction [nitrofen results in decreased expression of KCNMA1 protein] CTD PMID:15088113 Kcnma1 Rat dexamethasone multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of KCNMA1 mRNA CTD PMID:28628672 Kcnma1 Rat dexamethasone multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 mRNA and [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 protein CTD PMID:27605626 Kcnma1 Rat diarsenic trioxide increases expression ISO KCNMA1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of KCNMA1 mRNA CTD PMID:20458559 Kcnma1 Rat dibutyl phthalate decreases expression ISO Kcnma1 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of KCNMA1 mRNA CTD PMID:21266533 Kcnma1 Rat dioxygen decreases response to substance EXP 6480464 KCNMA1 mRNA alternative form results in decreased susceptibility to Oxygen deficiency CTD PMID:28090300 Kcnma1 Rat dioxygen increases expression EXP 6480464 Oxygen deficiency results in increased expression of KCNMA1 mRNA alternative form and Oxygen deficiency results in increased expression of KCNMA1 protein alternative form CTD PMID:28090300 Kcnma1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of KCNMA1 mRNA CTD PMID:29391264 Kcnma1 Rat endosulfan decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Endosulfan results in decreased expression of KCNMA1 mRNA CTD PMID:30090376 Kcnma1 Rat epoxiconazole increases expression ISO Kcnma1 (Mus musculus) 6480464 epoxiconazole results in increased expression of KCNMA1 mRNA CTD PMID:35436446 Kcnma1 Rat ethanol increases activity ISO Kcnma1 (Mus musculus) 6480464 Ethanol results in increased activity of KCNMA1 protein CTD PMID:16626657 Kcnma1 Rat ethanol increases expression ISO Kcnma1 (Mus musculus) 6480464 Ethanol results in increased expression of KCNMA1 mRNA CTD PMID:30319688 Kcnma1 Rat ethanol affects splicing ISO Kcnma1 (Mus musculus) 6480464 Ethanol affects the splicing of KCNMA1 mRNA CTD PMID:30319688 Kcnma1 Rat folic acid decreases expression ISO Kcnma1 (Mus musculus) 6480464 Folic Acid results in decreased expression of KCNMA1 mRNA CTD PMID:25629700 Kcnma1 Rat formaldehyde increases expression EXP 6480464 Formaldehyde results in increased expression of KCNMA1 protein CTD PMID:30974163 Kcnma1 Rat fructose multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:37567420 Kcnma1 Rat fulvestrant multiple interactions EXP 6480464 fulvestrant inhibits the reaction [Estradiol results in decreased expression of KCNMA1 mRNA alternative form] more ... CTD PMID:16102753 Kcnma1 Rat fulvestrant multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of KCNMA1 gene CTD PMID:31601247 Kcnma1 Rat fulvestrant increases methylation ISO KCNMA1 (Homo sapiens) 6480464 Fulvestrant results in increased methylation of KCNMA1 gene CTD PMID:31601247 Kcnma1 Rat genistein increases expression ISO Kcnma1 (Mus musculus) 6480464 Genistein results in increased expression of KCNMA1 mRNA CTD PMID:32186404 Kcnma1 Rat glucose multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 Glucose inhibits the reaction [[KCNMA1 protein binds to KCNMB1 protein] which results in decreased expression of BCL2 protein] more ... CTD PMID:21413024 Kcnma1 Rat glucose multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:37567420 Kcnma1 Rat hydrogen peroxide affects response to substance EXP 6480464 KCNMA1 mRNA affects the susceptibility to Hydrogen Peroxide CTD PMID:19247476 Kcnma1 Rat indometacin multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 mRNA and [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein co-treated with Indomethacin co-treated with rosiglitazone co-treated with Triiodothyronine] results in increased expression of KCNMA1 protein CTD PMID:27605626 Kcnma1 Rat indometacin multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of KCNMA1 mRNA CTD PMID:28628672 Kcnma1 Rat inulin multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of KCNMA1 mRNA CTD PMID:36331819 Kcnma1 Rat Lasiocarpine decreases expression ISO KCNMA1 (Homo sapiens) 6480464 lasiocarpine results in decreased expression of KCNMA1 mRNA CTD PMID:32234424 and PMID:35690182 Kcnma1 Rat lithocholic acid multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [KCNMB1 protein co-treated with KCNMA1 protein] results in increased susceptibility to Lithocholic Acid more ... CTD PMID:22123969 Kcnma1 Rat lithocholic acid increases response to substance ISO KCNMA1 (Homo sapiens) 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Lithocholic Acid CTD PMID:28090300 Kcnma1 Rat lithocholic acid multiple interactions EXP 6480464 Lithocholic Acid analog results in increased activity of [KCNMB1 protein co-treated with KCNMA1 protein] and Lithocholic Acid results in increased activity of [KCNMB1 protein co-treated with KCNMA1 protein] CTD PMID:18650555 Kcnma1 Rat lithocholic acid increases response to substance EXP 6480464 KCNMA1 mRNA alternative form results in increased susceptibility to Lithocholic Acid and KCNMA1 protein results in increased susceptibility to Lithocholic Acid CTD PMID:18242174 and PMID:28090300 Kcnma1 Rat malathion increases methylation ISO KCNMA1 (Homo sapiens) 6480464 Malathion results in increased methylation of KCNMA1 promoter CTD PMID:37047231 Kcnma1 Rat malathion decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Malathion results in decreased expression of KCNMA1 mRNA CTD PMID:37047231 Kcnma1 Rat maneb multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Paraquat co-treated with Maneb] affects the expression of KCNMA1 mRNA CTD PMID:22563483 Kcnma1 Rat manganese atom multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat manganese(0) multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat manganese(II) chloride multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat methapyrilene decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Methapyrilene results in decreased expression of KCNMA1 mRNA CTD PMID:31555880 Kcnma1 Rat methapyrilene increases expression ISO KCNMA1 (Homo sapiens) 6480464 Methapyrilene results in increased expression of KCNMA1 mRNA CTD PMID:35690182 Kcnma1 Rat methapyrilene affects methylation ISO KCNMA1 (Homo sapiens) 6480464 Methapyrilene affects the methylation of KCNMA1 intron CTD PMID:30157460 Kcnma1 Rat methotrexate increases expression ISO KCNMA1 (Homo sapiens) 6480464 Methotrexate results in increased expression of KCNMA1 mRNA CTD PMID:24449571 Kcnma1 Rat methoxychlor increases methylation EXP 6480464 Methoxychlor results in increased methylation of KCNMA1 gene CTD PMID:23303685 Kcnma1 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of KCNMA1 gene CTD PMID:35440735 Kcnma1 Rat mifepristone decreases expression EXP 6480464 Mifepristone results in decreased expression of KCNMA1 mRNA CTD PMID:25972201 Kcnma1 Rat N-Nitrosopyrrolidine decreases expression ISO KCNMA1 (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in decreased expression of KCNMA1 mRNA CTD PMID:32234424 and PMID:35690182 Kcnma1 Rat nickel atom multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of KCNMA1 mRNA] CTD PMID:14575637 Kcnma1 Rat nickel atom decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Nickel results in decreased expression of KCNMA1 mRNA CTD PMID:24768652 and PMID:25583101 Kcnma1 Rat nickel atom affects expression ISO KCNMA1 (Homo sapiens) 6480464 Nickel affects the expression of KCNMA1 mRNA CTD PMID:14575637 Kcnma1 Rat nitrofen decreases expression EXP 6480464 nitrofen results in decreased expression of KCNMA1 mRNA and nitrofen results in decreased expression of KCNMA1 protein CTD PMID:15088113 and PMID:33484710 Kcnma1 Rat nitrofen multiple interactions EXP 6480464 Dexamethasone inhibits the reaction [nitrofen results in decreased expression of KCNMA1 mRNA] and Dexamethasone inhibits the reaction [nitrofen results in decreased expression of KCNMA1 protein] CTD PMID:15088113 Kcnma1 Rat NS 1619 multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 NS 1619 binds to and results in increased activity of KCNMA1 protein more ... CTD PMID:21413024 Kcnma1 Rat O-methyleugenol decreases expression ISO KCNMA1 (Homo sapiens) 6480464 methyleugenol results in decreased expression of KCNMA1 mRNA CTD PMID:32234424 and PMID:35690182 Kcnma1 Rat ozone multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of KCNMA1 mRNA CTD PMID:27106289 Kcnma1 Rat paclitaxel affects response to substance ISO KCNMA1 (Homo sapiens) 6480464 KCNMA1 protein affects the susceptibility to Paclitaxel CTD PMID:16217747 Kcnma1 Rat paraquat multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [Paraquat co-treated with Maneb] affects the expression of KCNMA1 mRNA CTD PMID:22563483 Kcnma1 Rat paraquat increases expression ISO Kcnma1 (Mus musculus) 6480464 Paraquat results in increased expression of KCNMA1 mRNA CTD PMID:22563483 Kcnma1 Rat paxilline affects response to substance EXP 6480464 KCNMA1 protein affects the susceptibility to paxilline CTD PMID:22226998 Kcnma1 Rat PCB138 multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Kcnma1 Rat pentanal increases expression ISO KCNMA1 (Homo sapiens) 6480464 pentanal results in increased expression of KCNMA1 mRNA CTD PMID:26079696 Kcnma1 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of KCNMA1 mRNA CTD PMID:36331819 Kcnma1 Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of KCNMA1 mRNA CTD PMID:35163327 Kcnma1 Rat pergolide decreases activity EXP 6480464 Pergolide results in decreased activity of KCNMA1 protein CTD PMID:16129789 Kcnma1 Rat phloretin affects response to substance EXP 6480464 KCNMA1 mRNA affects the susceptibility to Phloretin CTD PMID:19247476 Kcnma1 Rat piroxicam multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [Piroxicam co-treated with Cisplatin] results in increased expression of KCNMA1 mRNA CTD PMID:21858171 Kcnma1 Rat potassium atom increases transport ISO Kcnma1 (Mus musculus) 6480464 KCNMA1 protein results in increased transport of Potassium CTD PMID:16020453 Kcnma1 Rat potassium atom affects transport EXP 6480464 KCNMA1 protein affects the transport of Potassium CTD PMID:22226998 Kcnma1 Rat progesterone multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of KCNMA1 mRNA and Progesterone inhibits the reaction [Estradiol results in increased activity of KCNMA1 protein] CTD PMID:18068743 and PMID:20660070 Kcnma1 Rat progesterone increases expression ISO KCNMA1 (Homo sapiens) 6480464 Progesterone results in increased expression of KCNMA1 mRNA and Progesterone results in increased expression of KCNMA1 protein CTD PMID:21795739 Kcnma1 Rat progesterone decreases activity ISO KCNMA1 (Homo sapiens) 6480464 Progesterone results in decreased activity of KCNMA1 protein CTD PMID:18068743 Kcnma1 Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of KCNMA1 mRNA and Progesterone results in increased expression of KCNMA1 mRNA alternative form CTD PMID:16102753 Kcnma1 Rat propanal increases expression ISO KCNMA1 (Homo sapiens) 6480464 propionaldehyde results in increased expression of KCNMA1 mRNA CTD PMID:26079696 Kcnma1 Rat pyridaben increases expression ISO Kcnma1 (Mus musculus) 6480464 pyridaben results in increased expression of KCNMA1 mRNA CTD PMID:22563483 Kcnma1 Rat rubidium atom affects activity ISO Kcnma1 (Mus musculus) 6480464 Rubidium affects the activity of KCNMA1 protein CTD PMID:16636204 Kcnma1 Rat silicon dioxide increases expression ISO KCNMA1 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of KCNMA1 mRNA CTD PMID:25895662 Kcnma1 Rat sodium arsenite affects methylation ISO KCNMA1 (Homo sapiens) 6480464 sodium arsenite affects the methylation of KCNMA1 gene CTD PMID:28589171 Kcnma1 Rat sodium arsenite decreases expression ISO Kcnma1 (Mus musculus) 6480464 sodium arsenite results in decreased expression of KCNMA1 mRNA CTD PMID:37682722 Kcnma1 Rat sodium arsenite multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of KCNMA1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of KCNMA1 mRNA CTD PMID:39836092 Kcnma1 Rat sodium arsenite decreases expression ISO KCNMA1 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of KCNMA1 mRNA CTD PMID:29301061 Kcnma1 Rat sodium disulfite increases expression EXP 6480464 sodium metabisulfite results in increased expression of KCNMA1 mRNA and sodium metabisulfite results in increased expression of KCNMA1 protein CTD PMID:25463229 Kcnma1 Rat sulfur dioxide increases expression EXP 6480464 Sulfur Dioxide results in increased expression of KCNMA1 mRNA and Sulfur Dioxide results in increased expression of KCNMA1 protein CTD PMID:26112951 Kcnma1 Rat T-2 toxin increases expression ISO KCNMA1 (Homo sapiens) 6480464 T-2 Toxin results in increased expression of KCNMA1 mRNA CTD PMID:31863870 Kcnma1 Rat tamoxifen multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 Tamoxifen inhibits the reaction [Glucose inhibits the reaction [[KCNMA1 protein binds to KCNMB1 protein] which results in decreased expression of BCL2 protein]] and Tamoxifen inhibits the reaction [Glucose results in decreased activity of [KCNMA1 protein binds to KCNMB1 protein]] CTD PMID:21413024 Kcnma1 Rat tamoxifen multiple interactions EXP 6480464 [bexarotene co-treated with Tamoxifen] results in decreased expression of KCNMA1 mRNA CTD PMID:17630414 Kcnma1 Rat temozolomide decreases expression ISO KCNMA1 (Homo sapiens) 6480464 Temozolomide results in decreased expression of KCNMA1 mRNA CTD PMID:31758290 Kcnma1 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of KCNMA1 mRNA and Carbon Tetrachloride results in increased expression of KCNMA1 protein CTD PMID:16644059 more ... Kcnma1 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of KCNMA1 mRNA CTD PMID:31150632 Kcnma1 Rat tetraethylammonium multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 Tetraethylammonium inhibits the reaction [Estradiol results in increased activity of KCNMA1 protein] more ... CTD PMID:18068743 and PMID:21413024 Kcnma1 Rat thallium affects activity ISO Kcnma1 (Mus musculus) 6480464 Thallium affects the activity of KCNMA1 protein CTD PMID:16636204 Kcnma1 Rat thallium multiple interactions EXP 6480464 [thallium sulfate results in increased abundance of Thallium] which results in decreased expression of KCNMA1 mRNA CTD PMID:39361050 Kcnma1 Rat thallium sulfate multiple interactions EXP 6480464 [thallium sulfate results in increased abundance of Thallium] which results in decreased expression of KCNMA1 mRNA CTD PMID:39361050 Kcnma1 Rat thiram increases expression ISO KCNMA1 (Homo sapiens) 6480464 Thiram results in increased expression of KCNMA1 mRNA CTD PMID:38568856 Kcnma1 Rat titanium dioxide increases methylation ISO Kcnma1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of KCNMA1 promoter CTD PMID:35295148 Kcnma1 Rat titanium dioxide decreases methylation ISO Kcnma1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of KCNMA1 gene and titanium dioxide results in decreased methylation of KCNMA1 promoter CTD PMID:35295148 Kcnma1 Rat toluene decreases activity ISO Kcnma1 (Mus musculus) 6480464 Toluene results in decreased activity of KCNMA1 protein CTD PMID:16626657 Kcnma1 Rat topotecan affects response to substance ISO KCNMA1 (Homo sapiens) 6480464 KCNMA1 protein affects the susceptibility to Topotecan CTD PMID:16217747 Kcnma1 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of KCNMA1 mRNA CTD PMID:33387578 Kcnma1 Rat trichostatin A multiple interactions ISO KCNMA1 (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of KCNMA1 mRNA] CTD PMID:14575637 Kcnma1 Rat trichostatin A decreases expression ISO KCNMA1 (Homo sapiens) 6480464 trichostatin A results in decreased expression of KCNMA1 mRNA CTD PMID:24935251 Kcnma1 Rat valproic acid affects expression ISO Kcnma1 (Mus musculus) 6480464 Valproic Acid affects the expression of KCNMA1 mRNA CTD PMID:17292431 Kcnma1 Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of KCNMA1 mRNA CTD PMID:29427782 Kcnma1 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of KCNMA1 mRNA CTD PMID:19015723 Kcnma1 Rat vinclozolin decreases methylation EXP 6480464 vinclozolin results in decreased methylation of KCNMA1 gene CTD PMID:31682807 Kcnma1 Rat XL147 multiple interactions ISO Kcnma1 (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with XL147] results in decreased expression of KCNMA1 mRNA CTD PMID:27935865
(+)-pilocarpine (EXP) (+)-Pimaric acid (EXP) (R)-noradrenaline (EXP) 1,2-dichloroethane (ISO) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,4-D (ISO) 2-bromohexadecanoic acid (ISO) 2-methylcholine (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,3',5-triiodo-L-thyronine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) acetylcholine (EXP) acrylamide (ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) aldehydo-D-glucose (ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (EXP) amiodarone (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bexarotene (EXP) bis(2-chloroethyl) sulfide (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) buta-1,3-diene (ISO) cadmium atom (ISO) cadmium dichloride (EXP,ISO) caesium atom (ISO) calcium atom (EXP,ISO) calcium(0) (EXP,ISO) CGP 52608 (ISO) chlordecone (ISO) cisplatin (ISO) clothianidin (ISO) copper atom (EXP) copper(0) (EXP) Cuprizon (EXP) D-glucose (ISO) decabromodiphenyl ether (EXP) dexamethasone (EXP,ISO) diarsenic trioxide (ISO) dibutyl phthalate (ISO) dioxygen (EXP) endosulfan (EXP,ISO) epoxiconazole (ISO) ethanol (ISO) folic acid (ISO) formaldehyde (EXP) fructose (ISO) fulvestrant (EXP,ISO) genistein (ISO) glucose (ISO) hydrogen peroxide (EXP) indometacin (ISO) inulin (ISO) Lasiocarpine (ISO) lithocholic acid (EXP,ISO) malathion (ISO) maneb (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methapyrilene (ISO) methotrexate (ISO) methoxychlor (EXP) mifepristone (EXP) N-Nitrosopyrrolidine (ISO) nickel atom (ISO) nitrofen (EXP) NS 1619 (ISO) O-methyleugenol (ISO) ozone (ISO) paclitaxel (ISO) paraquat (ISO) paxilline (EXP) PCB138 (ISO) pentanal (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP) pergolide (EXP) phloretin (EXP) piroxicam (ISO) potassium atom (EXP,ISO) progesterone (EXP,ISO) propanal (ISO) pyridaben (ISO) rubidium atom (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium disulfite (EXP) sulfur dioxide (EXP) T-2 toxin (ISO) tamoxifen (EXP,ISO) temozolomide (ISO) tetrachloromethane (EXP) tetraethylammonium (ISO) thallium (EXP,ISO) thallium sulfate (EXP) thiram (ISO) titanium dioxide (ISO) toluene (ISO) topotecan (ISO) trichloroethene (EXP) trichostatin A (ISO) valproic acid (EXP,ISO) vinclozolin (EXP) XL147 (ISO)
Biological Process
adult walking behavior (ISO) blood vessel diameter maintenance (IDA) chemical synaptic transmission (ISO) circadian rhythm (ISO) columnar/cuboidal epithelial cell maturation (ISO) eye blink reflex (ISO) inner ear auditory receptor cell differentiation (ISO) intracellular potassium ion homeostasis (IEA,ISO) locomotor rhythm (ISO) micturition (IEA,ISO) monoatomic ion transmembrane transport (IEA) monoatomic ion transport (IEA) negative regulation of cell volume (IEA,ISO) negative regulation of small intestine smooth muscle contraction (IMP) neuromuscular process controlling balance (ISO) neuron maturation (ISO) neuronal action potential (ISO) positive regulation of apoptotic process (IEA,ISO) positive regulation of membrane hyperpolarization (ISO) positive regulation of neuron apoptotic process (IMP) potassium ion transmembrane transport (IBA,IEA) potassium ion transport (IEA,ISO) regulation of aldosterone metabolic process (ISO) regulation of membrane potential (IBA,IEA,ISO) regulation of presynaptic membrane potential (IEA) relaxation of vascular associated smooth muscle (ISO) response to calcium ion (IDA,IEA,ISO) response to carbon monoxide (IEA,ISO) response to estrogen (IDA) response to hypoxia (IDA,IEA,ISO) response to osmotic stress (IEA,ISO) response to pH (IDA) saliva secretion (ISO) sensory perception of sound (ISO) smooth muscle contraction involved in micturition (IEA,ISO) transmembrane transport (IEA) vasodilation (IBA,IMP,ISO)
Cellular Component
apical plasma membrane (IEA,ISO) caveola (IEA,ISO) dendrite (IDA) endoplasmic reticulum (IEA,ISO) endoplasmic reticulum membrane (IEA) external side of plasma membrane (IDA,ISO) glutamatergic synapse (EXP,IDA) membrane (IEA,ISO) monoatomic ion channel complex (IEA) neuronal cell body (IDA) perinuclear region of cytoplasm (IDA) plasma membrane (IEA,ISO,TAS) postsynaptic membrane (IBA,ISO) presynaptic active zone membrane (IDA) protein-containing complex (IDA) sarcoplasm (ISO) terminal bouton (ISO) voltage-gated potassium channel complex (IEA,ISO)
Molecular Function
actin binding (IEA,ISO) calcium-activated potassium channel activity (IDA,IEA,IMP,ISO,TAS) identical protein binding (IPI,ISO) large conductance calcium-activated potassium channel activity (IBA,IDA,IEA,ISO) ligand-gated monoatomic ion channel activity involved in regulation of presynaptic membrane potential (EXP,IDA) metal ion binding (IEA) monoatomic ion channel activity (IEA) potassium channel activity (IEA,ISO) protein binding (IPI,ISO) protein-containing complex binding (IPI) voltage-gated potassium channel activity (IDA,IEA,IMP,ISO)
1.
Stimulatory action of internal protons on Slo1 BK channels.
Avdonin V, etal., Biophys J. 2003 May;84(5):2969-80.
2.
BKCa-Cav channel complexes mediate rapid and localized Ca2+-activated K+ signaling.
Berkefeld H, etal., Science. 2006 Oct 27;314(5799):615-20.
3.
Replication study of genome-wide associated SNPs with late-onset Alzheimer's disease.
Burns LC, etal., Am J Med Genet B Neuropsychiatr Genet. 2011 Jun;156B(4):507-12. doi: 10.1002/ajmg.b.31194. Epub 2011 Apr 7.
4.
Activation of BKca channels mediates hippocampal neuronal death after reoxygenation and reperfusion.
Chen M, etal., Mol Neurobiol. 2013 Dec;48(3):794-807. doi: 10.1007/s12035-013-8467-x. Epub 2013 May 8.
5.
Steady-state and closed-state inactivation properties of inactivating BK channels.
Ding JP and Lingle CJ, Biophys J 2002 May;82(5):2448-65.
6.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
7.
Properties of large conductance calcium-activated potassium channels in pyramidal neurons from the hippocampal CA1 region of adult rats.
Gong LW, etal., Jpn J Physiol 2001 Dec;51(6):725-31.
8.
Functional effects of auxiliary beta4-subunit on rat large-conductance Ca(2+)-activated K(+) channel.
Ha TS, etal., Biophys J. 2004 May;86(5):2871-82.
9.
Functional characteristics of two BKCa channel variants differentially expressed in rat brain tissues.
Ha TS, etal., Eur J Biochem 2000 Feb;267(3):910-8.
10.
Presynaptic Ca2+-activated K+ channels in glutamatergic hippocampal terminals and their role in spike repolarization and regulation of transmitter release.
Hu H, etal., J Neurosci. 2001 Dec 15;21(24):9585-97.
11.
Quercetin relaxes rat tail main artery partly via a PKG-mediated stimulation of KCa 1.1 channels.
Iozzi D, etal., Acta Physiol (Oxf). 2013 Aug;208(4):329-39. doi: 10.1111/apha.12083. Epub 2013 Mar 25.
12.
Heme is a carbon monoxide receptor for large-conductance Ca2+-activated K+ channels.
Jaggar JH, etal., Circ Res. 2005 Oct 14;97(8):805-12. doi: 10.1161/01.RES.0000186180.47148.7b. Epub 2005 Sep 15.
13.
Relaxant effect of chloroquine in rat ileum: possible involvement of nitric oxide and BKCa.
Jing F, etal., J Pharm Pharmacol. 2013 Jun;65(6):847-54. doi: 10.1111/jphp.12041. Epub 2013 Feb 28.
14.
Identification and functional characterization of cereblon as a binding protein for large-conductance calcium-activated potassium channel in rat brain.
Jo S, etal., J Neurochem. 2005 Sep;94(5):1212-24. Epub 2005 Jul 25.
15.
Enhanced K(+) secretion in dextran sulfate-induced colitis reflects upregulation of large conductance apical K(+) channels (BK; Kcnma1).
Kanthesh BM, etal., Am J Physiol Cell Physiol. 2013 Nov 1;305(9):C972-80. doi: 10.1152/ajpcell.00165.2013. Epub 2013 Aug 28.
16.
Myelin basic protein as a binding partner and calmodulin adaptor for the BKCa channel.
Kim H, etal., Proteomics. 2007 Aug;7(15):2591-602.
17.
Regulation of alternative splicing of Slo K+ channels in adrenal and pituitary during the stress-hyporesponsive period of rat development.
Lai GJ and McCobb DP, Endocrinology. 2006 Aug;147(8):3961-7. Epub 2006 May 4.
18.
Opposing actions of adrenal androgens and glucocorticoids on alternative splicing of Slo potassium channels in bovine chromaffin cells.
Lai GJ and McCobb DP, Proc Natl Acad Sci U S A 2002 May 28;99(11):7722-7.
19.
Thromboxane A2 receptor and MaxiK-channel intimate interaction supports channel trans-inhibition independent of G-protein activation.
Li M, etal., Proc Natl Acad Sci U S A. 2010 Nov 2;107(44):19096-101. doi: 10.1073/pnas.1002685107. Epub 2010 Oct 19.
20.
Assembly of a Ca2+-dependent BK channel signaling complex by binding to beta2 adrenergic receptor.
Liu G, etal., EMBO J. 2004 Jun 2;23(11):2196-205. Epub 2004 May 13.
21.
Increased expression of Ca2+-sensitive K+ channels in aorta of hypertensive rats.
Liu Y, etal., Hypertension. 1997 Dec;30(6):1403-9. doi: 10.1161/01.hyp.30.6.1403.
22.
Decreased expression of voltage- and Ca(2+)-activated K(+) channels in coronary smooth muscle during aging.
Marijic J, etal., Circ Res. 2001 Feb 2;88(2):210-6.
23.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
24.
Identification and localization of Ca(2+)-activated K+ channels in rat sciatic nerve.
Mi H, etal., Glia. 1999 Apr;26(2):166-75.
25.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
26.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
27.
Direct interaction between BKCa potassium channel and microtubule-associated protein 1A.
Park SM, etal., FEBS Lett. 2004 Jul 16;570(1-3):143-8.
28.
GOA pipeline
RGD automated data pipeline
29.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
30.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
31.
Leptin inhibits rat hippocampal neurons via activation of large conductance calcium-activated K+ channels.
Shanley LJ, etal., Nat Neurosci 2002 Apr;5(4):299-300.
32.
Aging decreases the contribution of MaxiK channel in regulating vascular tone in mesenteric artery by unparallel downregulation of alpha- and beta1-subunit expression.
Shi L, etal., Mech Ageing Dev. 2013 Sep;134(9):416-25. doi: 10.1016/j.mad.2013.09.001. Epub 2013 Sep 16.
33.
Nitric oxide enhances Ca(2+)-dependent K(+) channel activity in rat carotid body cells.
Silva JM and Lewis DL, Pflugers Arch 2002 Mar;443(5-6):671-5.
34.
MitoBK(Ca) is encoded by the Kcnma1 gene, and a splicing sequence defines its mitochondrial location.
Singh H, etal., Proc Natl Acad Sci U S A. 2013 Jun 25;110(26):10836-41. doi: 10.1073/pnas.1302028110. Epub 2013 Jun 10.
35.
[Ca(2+)-activated K(+) channel switching in smooth muscle participates in atherosclerosis development in diabetic rats].
Wang Y, etal., Nan Fang Yi Ke Da Xue Xue Bao. 2014 Feb;34(2):188-92.
36.
Hemoxygenase-2 is an oxygen sensor for a calcium-sensitive potassium channel.
Williams SE, etal., Science. 2004 Dec 17;306(5704):2093-7. Epub 2004 Nov 4.
37.
Control of alternative splicing of potassium channels by stress hormones.
Xie J and McCobb DP, Science 1998 Apr 17;280(5362):443-6.
38.
Alternative splicing of Slo channel gene programmed by estrogen, progesterone and pregnancy.
Zhu N, etal., FEBS Lett. 2005 Aug 29;579(21):4856-60.
Kcnma1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 351,065 - 1,057,117 (+) NCBI GRCr8 mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 302,214 - 1,001,198 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 309,515 - 1,014,692 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 1,696,105 - 2,401,327 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 308,241 - 1,013,437 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 344,204 - 1,048,849 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 344,360 - 1,047,956 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 339,100 - 1,037,105 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 575,136 - 950,275 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 322,288 - 950,273 NCBI Celera 15 3,556,267 - 4,246,392 (-) NCBI Celera Cytogenetic Map 15 p16 NCBI
KCNMA1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 10 76,869,602 - 77,637,808 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 10 76,869,601 - 77,638,369 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 10 78,629,360 - 79,397,566 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 10 78,299,366 - 79,067,583 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 10 78,314,640 - 79,067,583 NCBI Celera 10 71,914,113 - 72,684,182 (-) NCBI Celera Cytogenetic Map 10 q22.3 NCBI HuRef 10 72,624,294 - 73,391,824 (-) NCBI HuRef CHM1_1 10 78,911,952 - 79,680,009 (-) NCBI CHM1_1 T2T-CHM13v2.0 10 77,738,326 - 78,506,527 (-) NCBI T2T-CHM13v2.0
Kcnma1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 23,342,356 - 24,055,173 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 23,339,499 - 24,064,559 (-) Ensembl GRCm39 Ensembl GRCm38 14 23,292,288 - 24,005,110 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 23,289,431 - 24,014,491 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 24,117,983 - 24,823,427 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 22,088,573 - 22,792,482 (-) NCBI MGSCv36 mm8 Celera 14 19,676,577 - 20,379,488 (-) NCBI Celera Cytogenetic Map 14 A3 NCBI cM Map 14 12.92 NCBI
Kcnma1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955437 14,749,914 - 15,454,028 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955437 14,749,808 - 15,457,274 (+) NCBI ChiLan1.0 ChiLan1.0
KCNMA1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 8 89,019,281 - 89,786,611 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 10 89,024,606 - 89,791,821 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 10 73,391,297 - 74,158,488 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 10 76,053,915 - 76,820,639 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 10 76,062,047 - 76,820,644 (-) Ensembl panpan1.1 panPan2
KCNMA1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 4 26,844,250 - 27,338,271 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 4 26,844,250 - 27,555,776 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 4 26,970,672 - 27,681,029 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 4 27,145,564 - 27,857,706 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 4 27,143,848 - 27,857,493 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 4 27,020,780 - 27,731,400 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 4 27,220,327 - 27,931,096 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 4 27,571,588 - 28,283,070 (-) NCBI UU_Cfam_GSD_1.0
Kcnma1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 53,507,382 - 54,220,539 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936521 2,000,109 - 2,705,365 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936521 2,000,113 - 2,706,010 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
KCNMA1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 79,352,005 - 80,106,295 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 79,345,382 - 80,106,337 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 85,796,582 - 85,996,706 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Sscrofa10.2 14 86,640,231 - 86,640,531 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Sscrofa10.2 14 86,138,921 - 86,358,528 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
KCNMA1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 9 53,727,790 - 54,557,252 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 9 54,182,910 - 54,554,716 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 14,223,140 - 14,987,512 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Kcnma1
.
Predicted Target Of
Count of predictions: 147 Count of miRNA genes: 96 Interacting mature miRNAs: 101 Transcripts: ENSRNOT00000065542, ENSRNOT00000066928 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
10401805 Kidm51 Kidney mass QTL 51 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 15 306329 45306329 Rat 1354657 Despr13 Despair related QTL 13 0.0022 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 15 1 29912054 Rat 1641887 Alcrsp14 Alcohol response QTL 14 response to alcohol trait (VT:0010489) brain neurotensin receptor 1 density (CMO:0002068) 15 1 42356671 Rat 2298549 Neuinf12 Neuroinflammation QTL 12 3.5 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 15 1 55302115 Rat 731170 Pur3 Proteinuria QTL 3 2.3 0.0005 urine protein amount (VT:0005160) urine protein excretion rate (CMO:0000759) 15 1 41686771 Rat 8552920 Pigfal8 Plasma insulin-like growth factor 1 level QTL 8 3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 15 1 34723002 Rat 8694361 Abfw6 Abdominal fat weight QTL 6 10.2 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 15 1 34723002 Rat 9589149 Insul29 Insulin level QTL 29 9.06 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 15 1 34723002 Rat
D15Rat73
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 821,049 - 821,287 (+) MAPPER mRatBN7.2 Rnor_6.0 15 873,565 - 873,802 NCBI Rnor6.0 Rnor_5.0 15 862,384 - 862,621 UniSTS Rnor5.0 RGSC_v3.4 15 766,501 - 766,738 UniSTS RGSC3.4 RGSC_v3.4 15 766,261 - 766,899 RGD RGSC3.4 RGSC_v3.1 15 766,502 - 766,738 RGD Celera 15 3,729,257 - 3,729,494 UniSTS RH 3.4 Map 15 34.9 RGD RH 3.4 Map 15 34.9 UniSTS RH 2.0 Map 15 0.0 RGD SHRSP x BN Map 15 3.9298 RGD FHH x ACI Map 15 0.04 RGD Cytogenetic Map 15 p16 UniSTS
D15Rat108
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 15 666,410 - 666,568 (+) Marker Load Pipeline mRatBN7.2 15 616,969 - 617,127 (+) MAPPER mRatBN7.2 Rnor_6.0 15 668,009 - 668,166 NCBI Rnor6.0 Rnor_5.0 15 658,019 - 658,176 UniSTS Rnor5.0 RGSC_v3.4 15 557,527 - 557,682 RGD RGSC3.4 RGSC_v3.4 15 557,528 - 557,685 UniSTS RGSC3.4 RGSC_v3.1 15 557,527 - 557,682 RGD Celera 15 3,933,166 - 3,933,327 UniSTS FHH x ACI Map 15 0.0 UniSTS FHH x ACI Map 15 0.0 RGD Cytogenetic Map 15 p16 UniSTS
D15Rat135
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 15 617,973 - 618,178 (+) Marker Load Pipeline mRatBN7.2 15 568,533 - 568,738 (+) MAPPER mRatBN7.2 Rnor_6.0 15 613,195 - 613,399 NCBI Rnor6.0 Rnor_5.0 15 603,180 - 603,384 UniSTS Rnor5.0 RGSC_v3.4 15 506,685 - 506,890 RGD RGSC3.4 RGSC_v3.4 15 506,686 - 506,890 UniSTS RGSC3.4 RGSC_v3.1 15 506,487 - 507,058 RGD Celera 15 3,981,511 - 3,981,715 UniSTS RH 2.0 Map 15 0.0 RGD SHRSP x BN Map 15 5.0199 RGD Cytogenetic Map 15 p16 UniSTS
U09383
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 1,000,025 - 1,000,132 (+) MAPPER mRatBN7.2 Rnor_6.0 15 1,047,677 - 1,047,783 NCBI Rnor6.0 Rnor_5.0 15 1,035,933 - 1,036,039 UniSTS Rnor5.0 RGSC_v3.4 15 949,103 - 949,209 UniSTS RGSC3.4 Celera 15 3,557,333 - 3,557,439 UniSTS Cytogenetic Map 15 p16 UniSTS
D14Mit208
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 874,983 - 875,093 (+) MAPPER mRatBN7.2 Rnor_6.0 15 927,494 - 927,603 NCBI Rnor6.0 Rnor_5.0 15 916,313 - 916,422 UniSTS Rnor5.0 RGSC_v3.4 15 820,431 - 820,540 UniSTS RGSC3.4 Celera 15 3,675,470 - 3,675,579 UniSTS Cytogenetic Map 15 p16 UniSTS
BE113518
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 355,078 - 355,236 (+) MAPPER mRatBN7.2 Rnor_6.0 15 399,231 - 399,388 NCBI Rnor6.0 Rnor_5.0 15 391,958 - 392,115 UniSTS Rnor5.0 RGSC_v3.4 15 375,345 - 375,502 UniSTS RGSC3.4 Celera 15 4,193,257 - 4,193,414 UniSTS RH 3.4 Map 15 28.9 UniSTS Cytogenetic Map 15 p16 UniSTS
WI-18797
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 990,952 - 991,117 (+) MAPPER mRatBN7.2 Rnor_6.0 15 1,038,604 - 1,038,768 NCBI Rnor6.0 Rnor_5.0 15 1,026,860 - 1,027,024 UniSTS Rnor5.0 RGSC_v3.4 15 940,030 - 940,194 UniSTS RGSC3.4 Celera 15 3,566,352 - 3,566,516 UniSTS Cytogenetic Map 15 p16 UniSTS
BF386160
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 711,476 - 711,641 (+) MAPPER mRatBN7.2 Rnor_6.0 15 763,072 - 763,236 NCBI Rnor6.0 Rnor_5.0 15 751,868 - 752,032 UniSTS Rnor5.0 RGSC_v3.4 15 656,277 - 656,441 UniSTS RGSC3.4 Celera 15 3,838,910 - 3,839,074 UniSTS RH 3.4 Map 15 35.0 UniSTS Cytogenetic Map 15 p16 UniSTS
BE101789
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 530,055 - 530,205 (+) MAPPER mRatBN7.2 Rnor_6.0 15 575,219 - 575,368 NCBI Rnor6.0 Rnor_5.0 15 564,821 - 564,970 UniSTS Rnor5.0 Celera 15 4,020,245 - 4,020,394 UniSTS RH 3.4 Map 15 31.6 UniSTS Cytogenetic Map 15 p16 UniSTS
BF405369
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 313,741 - 313,922 (+) MAPPER mRatBN7.2 Rnor_6.0 15 355,864 - 356,044 NCBI Rnor6.0 Rnor_5.0 15 350,760 - 350,940 UniSTS Rnor5.0 RGSC_v3.4 15 333,999 - 334,179 UniSTS RGSC3.4 Celera 15 4,234,546 - 4,234,726 UniSTS RH 3.4 Map 15 28.9 UniSTS Cytogenetic Map 15 p16 UniSTS
Kcnma1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 871,373 - 871,451 (+) MAPPER mRatBN7.2 Rnor_6.0 15 923,884 - 923,961 NCBI Rnor6.0 Rnor_5.0 15 912,703 - 912,780 UniSTS Rnor5.0 RGSC_v3.4 15 816,821 - 816,898 UniSTS RGSC3.4 Celera 15 3,679,111 - 3,679,188 UniSTS Cytogenetic Map 15 p16 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
47
113
66
65
34
25
34
6
191
95
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000065542 ⟹ ENSRNOP00000058962
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,414 - 1,001,198 (+) Ensembl Rnor_6.0 Ensembl 15 344,685 - 1,047,625 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000066928 ⟹ ENSRNOP00000061684
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,585 - 1,000,263 (+) Ensembl Rnor_6.0 Ensembl 15 344,710 - 1,047,914 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000077671 ⟹ ENSRNOP00000074702
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,214 - 1,000,252 (+) Ensembl Rnor_6.0 Ensembl 15 344,360 - 1,047,903 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000091318 ⟹ ENSRNOP00000071652
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 497,821 - 1,000,263 (+) Ensembl Rnor_6.0 Ensembl 15 675,085 - 1,047,956 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000096488 ⟹ ENSRNOP00000090930
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,414 - 1,001,198 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000105174 ⟹ ENSRNOP00000086150
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,414 - 1,001,198 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000109388 ⟹ ENSRNOP00000096569
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 497,821 - 991,893 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000109865 ⟹ ENSRNOP00000082424
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 302,214 - 991,893 (+) Ensembl
RefSeq Acc Id:
NM_001393699 ⟹ NP_001380628
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,925 - 1,057,117 (+) NCBI mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI
RefSeq Acc Id:
NM_001393700 ⟹ NP_001380629
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,925 - 1,057,117 (+) NCBI mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI
RefSeq Acc Id:
NM_001393701 ⟹ NP_001380630
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,925 - 1,057,117 (+) NCBI mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI
RefSeq Acc Id:
NM_031828 ⟹ NP_114016
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,925 - 1,057,117 (+) NCBI mRatBN7.2 15 302,480 - 1,007,675 (+) NCBI Rnor_6.0 15 344,204 - 1,048,849 (+) NCBI Rnor_5.0 15 339,100 - 1,037,105 (+) NCBI RGSC_v3.4 15 575,136 - 950,275 (+) RGD Celera 15 3,556,267 - 4,246,392 (-) RGD
Sequence:
GAATTCGGCACGAGCTGCGCGGGGACGGGCGGGGGACCCCGGGCCGGGGCGCAGCGCACACGCGTGGCGCACGCCAAGTGGACCGGGCGGCGCCGAAGGCACTCGGGATCGCGCTTTCGGAGCTTCGG
hide sequence
RefSeq Acc Id:
XM_063274699 ⟹ XP_063130769
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274700 ⟹ XP_063130770
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274701 ⟹ XP_063130771
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,246 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274702 ⟹ XP_063130772
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274703 ⟹ XP_063130773
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274704 ⟹ XP_063130774
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,245 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274705 ⟹ XP_063130775
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,245 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274706 ⟹ XP_063130776
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274707 ⟹ XP_063130777
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,244 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274708 ⟹ XP_063130778
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,247 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274709 ⟹ XP_063130779
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,246 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274710 ⟹ XP_063130780
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,246 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274711 ⟹ XP_063130781
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,248 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274712 ⟹ XP_063130782
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274713 ⟹ XP_063130783
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274714 ⟹ XP_063130784
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,248 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274715 ⟹ XP_063130785
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,247 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274716 ⟹ XP_063130786
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274717 ⟹ XP_063130787
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,249 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274718 ⟹ XP_063130788
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,252 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274719 ⟹ XP_063130789
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,252 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274720 ⟹ XP_063130790
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,249 - 1,042,711 (+) NCBI
RefSeq Acc Id:
XM_063274721 ⟹ XP_063130791
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,251 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274722 ⟹ XP_063130792
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274723 ⟹ XP_063130793
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274724 ⟹ XP_063130794
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,049,694 (+) NCBI
RefSeq Acc Id:
XM_063274725 ⟹ XP_063130795
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,252 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274726 ⟹ XP_063130796
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,084 - 596,200 (+) NCBI
RefSeq Acc Id:
XM_063274727 ⟹ XP_063130797
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,179 - 759,238 (+) NCBI
RefSeq Acc Id:
XM_063274728 ⟹ XP_063130798
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,065 - 382,168 (+) NCBI
RefSeq Acc Id:
XM_063274729 ⟹ XP_063130799
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,248 - 1,057,117 (+) NCBI
RefSeq Acc Id:
XM_063274730 ⟹ XP_063130800
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 351,250 - 1,042,711 (+) NCBI
RefSeq Acc Id:
NP_114016 ⟸ NM_031828
- Peptide Label:
isoform 1
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot), A0A8I6A598 (UniProtKB/TrEMBL)
- Sequence:
MANGGGGGGGGSSGSSGGGGGGGGGETALRMSSNIHANHLSLDASSSSSSSSSSSSSSSSSVHEPKMDALIIPVTMEVPCDSRGQRMWWAFLASSMVTFFGGLFIILLWRTLKYLWTVCCHCGGKTKE
hide sequence
Ensembl Acc Id:
ENSRNOP00000058962 ⟸ ENSRNOT00000065542
Ensembl Acc Id:
ENSRNOP00000074702 ⟸ ENSRNOT00000077671
Ensembl Acc Id:
ENSRNOP00000071652 ⟸ ENSRNOT00000091318
Ensembl Acc Id:
ENSRNOP00000061684 ⟸ ENSRNOT00000066928
Ensembl Acc Id:
ENSRNOP00000082424 ⟸ ENSRNOT00000109865
Ensembl Acc Id:
ENSRNOP00000096569 ⟸ ENSRNOT00000109388
Ensembl Acc Id:
ENSRNOP00000090930 ⟸ ENSRNOT00000096488
Ensembl Acc Id:
ENSRNOP00000086150 ⟸ ENSRNOT00000105174
RefSeq Acc Id:
NP_001380628 ⟸ NM_001393699
- Peptide Label:
isoform 2
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001380629 ⟸ NM_001393700
- Peptide Label:
isoform 3
- UniProtKB:
A6KKU6 (UniProtKB/TrEMBL), A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001380630 ⟸ NM_001393701
- Peptide Label:
isoform 4
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot), A0A8I6ABY5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130798 ⟸ XM_063274728
- Peptide Label:
isoform X30
RefSeq Acc Id:
XP_063130796 ⟸ XM_063274726
- Peptide Label:
isoform X28
RefSeq Acc Id:
XP_063130797 ⟸ XM_063274727
- Peptide Label:
isoform X29
RefSeq Acc Id:
XP_063130769 ⟸ XM_063274699
- Peptide Label:
isoform X1
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130770 ⟸ XM_063274700
- Peptide Label:
isoform X2
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130776 ⟸ XM_063274706
- Peptide Label:
isoform X8
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130777 ⟸ XM_063274707
- Peptide Label:
isoform X9
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130772 ⟸ XM_063274702
- Peptide Label:
isoform X4
- UniProtKB:
A0A0G2K8Q9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130773 ⟸ XM_063274703
- Peptide Label:
isoform X5
- UniProtKB:
A0A0G2K8Q9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130774 ⟸ XM_063274704
- Peptide Label:
isoform X6
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130775 ⟸ XM_063274705
- Peptide Label:
isoform X7
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130779 ⟸ XM_063274709
- Peptide Label:
isoform X11
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130780 ⟸ XM_063274710
- Peptide Label:
isoform X12
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_063130771 ⟸ XM_063274701
- Peptide Label:
isoform X3
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130785 ⟸ XM_063274715
- Peptide Label:
isoform X17
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot), F1LNC7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130778 ⟸ XM_063274708
- Peptide Label:
isoform X10
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130784 ⟸ XM_063274714
- Peptide Label:
isoform X16
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130781 ⟸ XM_063274711
- Peptide Label:
isoform X13
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130799 ⟸ XM_063274729
- Peptide Label:
isoform X31
- UniProtKB:
Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot), Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_063130787 ⟸ XM_063274717
- Peptide Label:
isoform X19
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130790 ⟸ XM_063274720
- Peptide Label:
isoform X22
- UniProtKB:
A0A8I5ZV96 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130786 ⟸ XM_063274716
- Peptide Label:
isoform X18
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL), A6KKU8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130793 ⟸ XM_063274723
- Peptide Label:
isoform X25
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130782 ⟸ XM_063274712
- Peptide Label:
isoform X14
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130783 ⟸ XM_063274713
- Peptide Label:
isoform X15
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130792 ⟸ XM_063274722
- Peptide Label:
isoform X24
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_063130794 ⟸ XM_063274724
- Peptide Label:
isoform X26
- UniProtKB:
Q9WUI3 (UniProtKB/Swiss-Prot), Q7TQ57 (UniProtKB/Swiss-Prot), Q7TQ56 (UniProtKB/Swiss-Prot), Q7TQ55 (UniProtKB/Swiss-Prot), Q7TMZ8 (UniProtKB/Swiss-Prot), Q7TMZ7 (UniProtKB/Swiss-Prot), Q62976 (UniProtKB/Swiss-Prot), O88659 (UniProtKB/Swiss-Prot), O55180 (UniProtKB/Swiss-Prot), O08626 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_063130800 ⟸ XM_063274730
- Peptide Label:
isoform X32
- UniProtKB:
A0A8I5ZV96 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130791 ⟸ XM_063274721
- Peptide Label:
isoform X23
- UniProtKB:
A0A0G2K8Q9 (UniProtKB/TrEMBL), A6KKU5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130795 ⟸ XM_063274725
- Peptide Label:
isoform X27
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130788 ⟸ XM_063274718
- Peptide Label:
isoform X20
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063130789 ⟸ XM_063274719
- Peptide Label:
isoform X21
- UniProtKB:
A6KKU7 (UniProtKB/TrEMBL)
RGD ID: 13699549 Promoter ID: EPDNEW_R10067 Type: multiple initiation site Name: Kcnma1_1 Description: potassium calcium-activated channel subfamily M alpha 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 15 344,718 - 344,778 EPDNEW
BioCyc Gene G2FUF-14611 BioCyc
Ensembl Genes ENSRNOG00000005985 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Ensembl Transcript ENSRNOT00000065542 ENTREZGENE
ENSRNOT00000065542.5 UniProtKB/TrEMBL
ENSRNOT00000066928 ENTREZGENE
ENSRNOT00000066928.4 UniProtKB/Swiss-Prot
ENSRNOT00000077671.2 UniProtKB/TrEMBL
ENSRNOT00000091318 ENTREZGENE
ENSRNOT00000091318.2 UniProtKB/TrEMBL
ENSRNOT00000096488.1 UniProtKB/TrEMBL
ENSRNOT00000105174 ENTREZGENE
ENSRNOT00000105174.1 UniProtKB/TrEMBL
ENSRNOT00000109388 ENTREZGENE
ENSRNOT00000109388.1 UniProtKB/TrEMBL
ENSRNOT00000109865 ENTREZGENE
ENSRNOT00000109865.1 UniProtKB/TrEMBL
Gene3D-CATH 1.10.287.70 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
NAD(P)-binding Rossmann-like Domain UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
InterPro Ion_trans_dom UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
K_chnl_BK_asu UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
K_chnl_Slo-like UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
NAD(P)-bd_dom_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Slo-like_RCK UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Slowpoke-like_C UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report rno:83731 UniProtKB/Swiss-Prot
NCBI Gene 83731 ENTREZGENE
PANTHER CALCIUM-ACTIVATED POTASSIUM CHANNEL ALPHA CHAIN UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PTHR10027:SF28 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pfam BK_channel_a UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Ion_trans UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Slo-like_RCK UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Slowpoke_C UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PhenoGen Kcnma1 PhenoGen
PRINTS BKCHANNELA UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KCHANNEL UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PROSITE RCK_N UniProtKB/Swiss-Prot
RatGTEx ENSRNOG00000005985 RatGTEx
Superfamily-SCOP SSF51735 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Voltage-gated potassium channels UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt A0A0G2K104_RAT UniProtKB/TrEMBL
A0A0G2K8Q9 ENTREZGENE, UniProtKB/TrEMBL
A0A8I5ZV96 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6A598 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6ABY5 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6ASR2_RAT UniProtKB/TrEMBL
A6KKU5 ENTREZGENE, UniProtKB/TrEMBL
A6KKU6 ENTREZGENE, UniProtKB/TrEMBL
A6KKU7 ENTREZGENE, UniProtKB/TrEMBL
A6KKU8 ENTREZGENE, UniProtKB/TrEMBL
F1LNC7 ENTREZGENE, UniProtKB/TrEMBL
KCMA1_RAT UniProtKB/Swiss-Prot
O08626 ENTREZGENE
O55180 ENTREZGENE
O88659 ENTREZGENE
Q62976 ENTREZGENE
Q7TMZ7 ENTREZGENE
Q7TMZ8 ENTREZGENE
Q7TQ55 ENTREZGENE
Q7TQ56 ENTREZGENE
Q7TQ57 ENTREZGENE
Q9WUI3 ENTREZGENE
UniProt Secondary O08626 UniProtKB/Swiss-Prot
O55180 UniProtKB/Swiss-Prot
O88659 UniProtKB/Swiss-Prot
Q7TMZ7 UniProtKB/Swiss-Prot
Q7TMZ8 UniProtKB/Swiss-Prot
Q7TQ55 UniProtKB/Swiss-Prot
Q7TQ56 UniProtKB/Swiss-Prot
Q7TQ57 UniProtKB/Swiss-Prot
Q9WUI3 UniProtKB/Swiss-Prot
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-11
Kcnma1
potassium calcium-activated channel subfamily M alpha 1
Kcnma1
potassium channel, calcium activated large conductance subfamily M alpha, member 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2015-01-26
Kcnma1
potassium channel, calcium activated large conductance subfamily M alpha, member 1
Kcnma1
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2013-04-17
Kcnma1
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
LOC498438
similar to potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Data merged from RGD:1591969
737654 PROVISIONAL
2006-11-20
LOC498438
similar to potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Symbol and Name status set to provisional
70820 PROVISIONAL
2004-09-10
Kcnma1
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Kcnma1
potassium large conductance calcium-activated channel, ubfamily M, alpha member 1
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
expressed in adrenal chromaffin cells
625439
gene_function
potassium large conductance calcium-activated channel
625439
gene_process
increases repetitive firing of chromaffin cells by minimizing action potential duration and speeding recovery of sodium channels from inactivation
625439
gene_regulation
production of splice variants are differentially regulated by glucocorticoids and androgens in adrenal chromaffin cells
625439
gene_regulation
channel acitivity is increased in a NO-mediated fashion
633138
