Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29b-3p URS000024463E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-29: Hsa-mir-29 is a type of microRNA that has been studied in relation to gene regulation [1]. One study has shown a connection between hsa-miR-142-5p and CD24 in terms of gene regulation [2]. Additionally, another study found a significant anti-correlation between the levels of hsa-mir-29 family members and DNMT3A/B mRNA levels in lung tumors [3]. These findings suggest that hsa-mir-29 may play a role in the regulation of genes involved in breast and lung tumors. Further research is needed to fully understand the mechanisms and implications of these relationships. References: 1. [1] Reference for the statement "Hsa-mir-29 is a type of microRNA that has been studied in relation to gene regulation." 2. [2] Reference for the statement "One study has shown a connection between hsa-miR-142-5p and CD24 in terms of gene regulation." 3. [3] Reference for the statement "Additionally, another study found a significant anti-correlation between the levels of hsa-mir-29 family members and DNMT3A/B mRNA levels in lung tumors."

mRNA interactions 55 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCAGUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis Ami-Mir-29-P1b-v1_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-29-P1d-v1_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29b
  4. Bos taurus (cattle) bta-miR-29b
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-29b
  6. Callorhinchus milii (elephant shark) Cmi-Mir-29-P1b_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-29b
  8. Cavia porcellus cpo-miR-29b-3p
  9. Chrysemys picta bellii Cpi-Mir-29-P1b-v1_3p (mature (guide))
  10. Columba livia (rock pigeon) cli-miR-29b-3p
  11. Cricetulus griseus cgr-miR-29b-3p
  12. Cyprinus carpio ccr-miR-29b
  13. Danio rerio (zebrafish) dre-miR-29b3-3p
  14. Dasypus novemcinctus dno-miR-29b-3p
  15. Echinops telfairi Ete-Mir-29-P1b-v1_3p (mature (guide))
  16. Equus caballus eca-miR-29b
  17. Gallus gallus (chicken) gga-miR-29b-3p
  18. Gekko japonicus Gja-Mir-29-P1b-v1_3p (mature (guide))
  19. Latimeria chalumnae Lch-Mir-29-P1b_3p (mature (guide))
  20. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P1b-v1_3p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
  22. Maylandia zebra (zebra mbuna) mze-miR-29b
  23. Microcaecilia unicolor Mun-Mir-29-P1d-v1_3p (mature (guide))
  24. Microcebus murinus (gray mouse lemur) mmr-miR-29b
  25. Monodelphis domestica Mdo-Mir-29-P1b-v1_3p (mature (guide))
  26. Monopterus albus Mal-Mir-29-P1d2-v1_3p (mature (guide))
  27. Mus musculus (house mouse) mmu-miR-29b-3p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29b
  29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29b
  30. Ophiophagus hannah (king cobra) oha-miR-29b-3p
  31. Ornithorhynchus anatinus Oan-Mir-29-P1b-v1_3p (mature (guide))
  32. Oryctolagus cuniculus ocu-miR-29b-3p
  33. Otolemur garnettii (small-eared galago) oga-miR-29b
  34. Pteropus alecto pal-miR-29b-3p
  35. Python bivittatus Pbv-Mir-29-P1d-v1_3p (mature (guide))
  36. Rattus norvegicus rno-miR-29b-3p
  37. Saccoglossus kowalevskii Sko-Mir-29-P1_3p (mature (guide))
  38. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P1b-v1_3p (mature (guide))
  39. Scyliorhinus torazame (cloudy catshark) Sto-Mir-29-P1d_3p (mature (guide))
  40. Sphenodon punctatus (tuatara) Spt-Mir-29-P1b_3p (mature (guide))
  41. Sus scrofa (pig) ssc-miR-29b
  42. Taeniopygia guttata Tgu-Mir-29-P1b-v1_3p (mature (guide))
  43. Tupaia chinensis tch-miR-29b-3p
  44. Xenopus laevis xla-miR-29b-3p
  45. Xenopus tropicalis xtr-miR-29b
Publications