URL: http://www.addgene.org/30116
Proper Citation: RRID:Addgene_30116
Bacterial Resistance: Ampicillin
Defining Citation: PMID:
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pFastBac His6 MBP N10 TEV LIC cloning vector (4C).
No alerts have been found for pFastBac His6 MBP N10 TEV LIC cloning vector (4C).
Source: Addgene