URL: http://www.addgene.org/37237
Proper Citation: RRID:Addgene_37237
Bacterial Resistance: Ampicillin
Defining Citation: PMID:
Vector Backbone Description: Backbone Size:5898; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2Cc-T has a TEV-cleavable C-terminal MBP tag to enhance solubility, as well as a His6 tag to ease purification. The TEV site is created after performing LIC cloning described below. To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3' Reverse - 5'GGATTGGAAGTAGAGGTTCTC3' Linearize the plasmid with HpaI and gel purify. When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET MBP His6 LIC cloning vector (2Cc-T).
No alerts have been found for pET MBP His6 LIC cloning vector (2Cc-T).
Source: Addgene