URL: http://www.addgene.org/41819
Proper Citation: RRID:Addgene_41819
Insert Name: gRNA_GFP-T1
Bacterial Resistance: Kanamycin
Defining Citation: PMID:23287722
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/ gRNA target sequence GTGAACCGCATCGAGCTGAA
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for gRNA_GFP-T1.
No alerts have been found for gRNA_GFP-T1.
Source: Addgene