You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/41819.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_41819 RRID Copied  
PDF Report How to cite
RRID:Addgene_41819
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/41819

Proper Citation: RRID:Addgene_41819

Insert Name: gRNA_GFP-T1

Bacterial Resistance: Kanamycin

Defining Citation: PMID:23287722

Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin

Comments: For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/ gRNA target sequence GTGAACCGCATCGAGCTGAA

Expand All
Usage and Citation Metrics
We apologize, the data for 2022 is currently unavailable for most resources. We are aware of the issue and are working to resolve it.

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for gRNA_GFP-T1.

No alerts have been found for gRNA_GFP-T1.

Data and Source Information

Source: Addgene