You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.wormbase.org/db/get?name=WBStrain00029076.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Organism Name
RRID:WB-STRAIN:WBStrain00029076 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00029076
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00029076

Proper Citation: RRID:WB-STRAIN:WBStrain00029076

Description: Caenorhabditis elegans with name rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. from WB.

Species: Caenorhabditis elegans

Synonyms: rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III.

Notes: jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

Affected Gene: WBGene00001063(dpy-1)|WBGene00004267(rab-3)|WBGene00022051(rep-1)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for NM4431.

No alerts have been found for NM4431.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)