URL: http://www.wormbase.org/db/get?name=WBStrain00029076
Proper Citation: RRID:WB-STRAIN:WBStrain00029076
Description: Caenorhabditis elegans with name rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. from WB.
Species: Caenorhabditis elegans
Synonyms: rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III.
Notes: jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
Affected Gene: WBGene00001063(dpy-1)|WBGene00004267(rab-3)|WBGene00022051(rep-1)
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for NM4431.
No alerts have been found for NM4431.
Source: Integrated Animals
Source Database: WormBase (WB)