You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/11938.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_11938 RRID Copied  
PDF Report How to cite
RRID:Addgene_11938
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/11938

Proper Citation: RRID:Addgene_11938

Insert Name: Ub-M-GFP

Bacterial Resistance: Kanamycin

Defining Citation: PMID:10802622

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3970; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

Expand All
Usage and Citation Metrics
We apologize, the data for 2022 is currently unavailable for most resources. We are aware of the issue and are working to resolve it.

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for Ub-M-GFP.

No alerts have been found for Ub-M-GFP.

Data and Source Information

Source: Addgene