URL: http://www.addgene.org/11938
Proper Citation: RRID:Addgene_11938
Insert Name: Ub-M-GFP
Bacterial Resistance: Kanamycin
Defining Citation: PMID:10802622
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3970; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for Ub-M-GFP.
No alerts have been found for Ub-M-GFP.
Source: Addgene