NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13376 Query DataSets for GPL13376
Status Public on Apr 06, 2011
Title Illumina HumanWG-6 v2.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html

HumanWG-6_V2_0_R4_11223189_A.txt
 
Submission date Apr 06, 2011
Last update date Feb 18, 2014
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (1584) GSM702490, GSM702491, GSM702492, GSM702493, GSM702494, GSM702495 
Series (30)
GSE28424 Modulation of the osteosarcoma expression phenotype by miRNAs [Illumina]
GSE28425 Modulation of the osteosarcoma expression phenotype by miRNAs
GSE28541 Characterization of gene expression profiles of gastric cancer in MD Anderson Cancer Center cohort

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Probe_Id
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Probe_Id Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC
ILMN_1910180 Homo sapiens Unigene ILMN_127219 ILMN_127219 HS.575038 Hs.575038 Hs.575038 10437021 AK024680 ILMN_1910180 2100682 S 1409 ACACCTTCAGGAGGGAAGCCCTTATTTCTGGGTTGAACTCCCCTTCCATG 2 + 206352194-206352243 Homo sapiens cDNA: FLJ21027 fis, clone CAE07110 AK024680
ILMN_1725881 Homo sapiens RefSeq ILMN_44919 ILMN_44919 LOC23117 XM_933824.1 XM_933824.1 23117 89040007 XM_933824.1 LOC23117 XP_938917.1 ILMN_1725881 2000349 I 122 GGCTCCTCTTTGGGCTCCTACTGGAATTTATCAGCCATCAGTGCATCTCT 16 - 21766363-21766363:21769901-21769949 16p12.2a PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 11 (LOC23117), mRNA. XM_933824.1
ILMN_1804174 Homo sapiens RefSeq ILMN_139282 ILMN_139282 FCGR2B XM_938851.1 XM_938851.1 2213 88952550 XM_938851.1 FCGR2B XP_943944.1 ILMN_1804174 1500347 I 1643 TAGGGGCAATAGGCTATACGCTACAGCCTAGGTGTGTAGTAGGCCACACC 1q23.3b PREDICTED: Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32) (FCGR2B), mRNA. The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [pmid 11955599] [evidence EXP]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [pmid 2139735] [evidence NAS]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat [goid 6955] [pmid 2142460] [evidence TAS]; The cascade of processes by which a signal interacts with a receptor, causing a change in the level or activity of a second messenger or other downstream target, and ultimately effecting a change in the functioning of the cell [goid 7165] [pmid 2142460] [evidence TAS]; Any process by which an organism has an effect on an organism of a different species [goid 44419] [evidence IEA] Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 11567028] [evidence IPI]; Interacting selectively with an immunoglobulin of an IgG isotype [goid 19864] [evidence IEA] XM_938851.1
ILMN_1761580 Homo sapiens RefSeq ILMN_5006 ILMN_5006 TRIM44 NM_017583.3 NM_017583.3 54765 29029528 NM_017583.3 TRIM44 NP_060053.2 ILMN_1761580 5050382 S 3104 AGGATTGTCCTGACTCACTAAAGATGCCAGGATATTGGGGCTGAGGGGAG 11 + 35786273-35786322 11p13a Homo sapiens tripartite motif-containing 44 (TRIM44), mRNA. MGC3490; MC7; HSA249128; DIPB MGC3490; MC7; HSA249128; DIPB NM_017583.3
ILMN_1758197 Homo sapiens RefSeq ILMN_38756 ILMN_38756 LOC653895 XM_936379.1 XM_936379.1 653895 89033487 XM_936379.1 LOC653895 XP_941472.1 ILMN_1758197 1440273 S 26 TAGCAGGGAGCGGTGAGGGAGAGCGGCTGGATTTCTTGCGGGATCTGCAC 10q11.23b PREDICTED: Homo sapiens similar to protein geranylgeranyltransferase type I, beta subunit (LOC653895), mRNA. XM_936379.1
ILMN_1750100 Homo sapiens RefSeq ILMN_3509 ILMN_3509 TUBB4Q NM_020040.3 NM_020040.3 56604 55770867 NM_020040.3 TUBB4Q NP_064424.3 ILMN_1750100 6900059 S 1196 GCGAGGGCATGGATGAGATGGAATTCACTGAGGCCGAGAGCAACATGAAC 4 - 191140731-191140780 4q35.2d Homo sapiens tubulin, beta polypeptide 4, member Q (TUBB4Q), mRNA. Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles [goid 5856] [pmid 10828619] [evidence TAS]; Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle [goid 5874] [evidence IEA]; Any macromolecular complex composed of two or more polypeptide subunits, which may or may not be identical. Protein complexes may have other associated non-protein prosthetic groups, such as nucleotides, metal ions or carbohydrate groups [goid 43234] [evidence IEA] Movement of organelles, other microtubules and other particles along microtubules, mediated by motor proteins [goid 7018] [evidence IEA]; The process of creating protein polymers, compounds composed of a large number of component monomers; polymeric proteins may be made up of different or identical monomers. Polymerization occurs by the addition of extra monomers to an existing poly- or oligomeric protein [goid 51258] [evidence IEA] Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; The action of a molecule that contributes to the structural integrity of a complex or assembly within or outside a cell [goid 5198] [pmid 10828619] [evidence TAS]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [evidence IEA] NM_020040.3
ILMN_1782441 Homo sapiens RefSeq ILMN_27587 ILMN_27587 CDKL2 NM_003948.2 NM_003948.2 8999 10938004 NM_003948.2 CDKL2 NP_003939.1 ILMN_1782441 3440762 S 1601 GCGTGGCAATTCCCCCACTTACACACAATCTTTCTGCAGTTGCTCCCAGC 4 - 76741189-76741238 4q21.1a Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase) (CDKL2), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA] The process of introducing a phosphate group on to a protein [goid 6468] [evidence IEA]; The cascade of processes by which a signal interacts with a receptor, causing a change in the level or activity of a second messenger or other downstream target, and ultimately effecting a change in the functioning of the cell [goid 7165] [pmid 9000130] [evidence TAS]; The establishment of the sex of an organism by physical differentiation [goid 7548] [pmid 9000130] [evidence TAS] Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the reaction: ATP + a protein = ADP + a phosphoprotein; dependent on the binding of a regulatory cyclin subunit and full activity requires stimulatory phosphorylation by a CDK-activating kinase (CAK) [goid 4693] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2 [goid 16740] [evidence IEA] KKIAMRE; P56 KKIAMRE; P56 NM_003948.2
ILMN_1668162 Homo sapiens RefSeq ILMN_7652 ILMN_7652 DGAT2L3 NM_001013579.1 NM_001013579.1 158833 61888901 NM_001013579.1 DGAT2L3 NP_001013597.1 ILMN_1668162 6480482 S 782 GTCAAGGCTCCACTGGGCTCCTGCCATACTCCAGGCCTATTGTCACTGTG X + 69376459-69376508 Xq13.1b Homo sapiens diacylglycerol O-acyltransferase 2-like 3 (DGAT2L3), mRNA. The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; The lipid bilayer surrounding the endoplasmic reticulum [goid 5789] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids [goid 6629] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA] Catalysis of the generalized reaction: acyl-carrier + reactant = acyl-reactant + carrier [goid 8415] [evidence IEA]; Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2 [goid 16740] [evidence IEA]; Catalysis of the reaction: a long-chain-alcohol + acyl-CoA = a long-chain ester + CoA [goid 47196] [evidence IEA] DGA2; AWAT1 DGA2; AWAT1 NM_001013579.1
ILMN_1715600 Homo sapiens RefSeq ILMN_35097 ILMN_35097 LOC387701 XM_373469.3 XM_373469.3 387701 89031576 XM_373469.3 LOC387701 XP_373469.1 ILMN_1715600 2350164 A 301 GTCCCCAACCCTAACCCGGACCTGGCACATACAAGACATTCAGCAGATGG 10 + 92811754-92811767:92811768-92811803 PREDICTED: Homo sapiens hypothetical LOC387701 (LOC387701), mRNA. XM_373469.3
ILMN_1912287 Homo sapiens Unigene ILMN_77451 ILMN_77451 HS.133181 Hs.133181 Hs.133181 27826545 BX093329 ILMN_1912287 4890754 S 324 GTGCCAGCTGCCATTGCACTGCCTCACATTTTCCTTTAGATGTTTGAGCA 3 + 153084777-153084826 BX093329 Soares_parathyroid_tumor_NbHPA Homo sapiens cDNA clone IMAGp998A124183 ; IMAGE:1648403, mRNA sequence BX093329
ILMN_1889125 Homo sapiens Unigene ILMN_108888 ILMN_108888 HS.545755 Hs.545755 Hs.545755 1999235 AA346998 ILMN_1889125 5420445 S 139 CTGGAAAAGCAAAATTTGGATTTGTGGTTCAATCCACCATCTTTACTCAG EST53225 Fetal heart II Homo sapiens cDNA 3 end, mRNA sequence AA346998
ILMN_1682799 Homo sapiens RefSeq ILMN_1387 ILMN_1387 STAMBPL1 NM_020799.2 NM_020799.2 57559 52694663 NM_020799.2 STAMBPL1 NP_065850.1 ILMN_1682799 7160255 S 1746 TGTAAGCACCGTCAACATCAGACACCTACTCATGGACATGTGGTTGCCGG 10 + 90672973-90673022 10q23.31b Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA. The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of a ubiquitin moiety, or multiple ubiquitin moieties, to the protein [goid 6511] [evidence IEA] Catalysis of the reaction: ubiquitin C-terminal thiolester + H2O = ubiquitin + a thiol. Hydrolysis of esters, including those formed between thiols such as dithiothreitol or glutathione and the C-terminal glycine residue of the polypeptide ubiquitin, and AMP-ubiquitin [goid 4221] [evidence IEA]; Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid [goid 8233] [evidence IEA]; Catalysis of the hydrolysis of peptide bonds by a mechanism in which water acts as a nucleophile, one or two metal ions hold the water molecule in place, and charged amino acid side chains are ligands for the metal ions [goid 8237] [evidence IEA]; Interacting selectively with zinc (Zn) ions [goid 8270] [evidence IEA]; Interacting selectively with any metal ion [goid 46872] [evidence IEA] KIAA1373; bA399O19.2; FLJ31524; AMSH-LP; AMSH-FP; ALMalpha KIAA1373; bA399O19.2; FLJ31524; AMSH-LP; AMSH-FP; ALMalpha NM_020799.2
ILMN_1909767 Homo sapiens Unigene ILMN_104330 ILMN_104330 HS.539137 Hs.539137 Hs.539137 6568782 AW236393 ILMN_1909767 4150719 S 239 ACCGCAGAGCCTTTGACCTCGGTACCTCAATATGAAGATTCAGGGTCTTC 15 + 94436213-94436262 xo15e10.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE:2704074 3, mRNA sequence AW236393
ILMN_1840770 Homo sapiens Unigene ILMN_88273 ILMN_88273 HS.372465 Hs.372465 Hs.372465 22919294 BU568994 ILMN_1840770 1010360 S 693 TAATCAGGACCCAGCAAATTTCCCCGAAGCAATGGGGTCCCGGTGGGCTC AGENCOURT_10400114 NIH_MGC_82 Homo sapiens cDNA clone IMAGE:6616301 5, mRNA sequence BU568994
ILMN_1906209 Homo sapiens Unigene ILMN_108918 ILMN_108918 HS.545796 Hs.545796 Hs.545796 6834513 AW337887 ILMN_1906209 1740255 S 39 GAAAGAGATTTTGGTAGGAGAGGGCTGAGGCTGACAGCGGGGAGATGCCA 9 + 41422205-41422254 he12d07.x1 NCI_CGAP_CML1 Homo sapiens cDNA clone IMAGE:2918797 3, mRNA sequence AW337887
ILMN_1665311 Homo sapiens RefSeq ILMN_1785 ILMN_1785 STH NM_001007532.1 NM_001007532.1 246744 56090268 NM_001007532.1 STH NP_001007533.1 ILMN_1665311 1050195 S 97 CAGCCTCTGTGTGAGTGGATGATTCAGGTTGCCAGAGACAGAACCCTCAG 17 + 41432579-41432628 17q21.31e Homo sapiens saitohin (STH), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA] MGC163193; MGC163191 MGC163193; MGC163191 NM_001007532.1
ILMN_1656744 Homo sapiens RefSeq ILMN_33919 ILMN_33919 LOC648054 XM_937104.1 XM_937104.1 648054 89028492 XM_937104.1 LOC648054 XP_942197.1 ILMN_1656744 7200546 S 1048 GACATCACTCGGTCTGTGACTTCGGTGCAATCTCCTTCAGGGAAGCCGGG PREDICTED: Homo sapiens hypothetical protein LOC648054 (LOC648054), mRNA. XM_937104.1
ILMN_1663142 Homo sapiens RefSeq ILMN_24114 ILMN_24114 CLEC12A NM_201625.1 NM_201625.1 160364 42490743 NM_201625.1 CLEC12A NP_963919.1 ILMN_1663142 1050121 A 1628 GGTGGCATGGCTCCCCATCTCGGGTCCATCCTATACTTCCATGGGACTCC 12 + 10029269-10029318 12p13.2c Homo sapiens C-type lectin domain family 12, member A (CLEC12A), transcript variant 3, mRNA. The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]; Interacting selectively with any mono-, di- or trisaccharide carbohydrate [goid 5529] [evidence IEA] DCAL-2; CLL1; CLL-1; MGC70602; MICL CLL1; MICL; CLL-1; DCAL-2; MGC70602 NM_201625.1
ILMN_1711453 Homo sapiens RefSeq ILMN_24114 ILMN_24114 CLEC12A NM_201625.1 NM_201625.1 160364 42490743 NM_201625.1 CLEC12A NP_963919.1 ILMN_1711453 4210615 I 481 GCCCACAAGGAGGACTTACAATGTGGAACTTAGTCTCTTTCCCTCACTCC 12 + 10023039-10023088 12p13.2c Homo sapiens C-type lectin domain family 12, member A (CLEC12A), transcript variant 3, mRNA. The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]; Interacting selectively with any mono-, di- or trisaccharide carbohydrate [goid 5529] [evidence IEA] DCAL-2; CLL1; CLL-1; MGC70602; MICL DCAL-2; CLL1; CLL-1; MGC70602; MICL NM_201625.1
ILMN_1816369 Homo sapiens Unigene ILMN_77735 ILMN_77735 HS.136401 Hs.136401 Hs.136401 2269251 AA527182 ILMN_1816369 6420553 S 473 AAGGTCAAGGGAGGCCGAAGGAGTGTGTCTTCCCCAGCTTTGTTGAGGCC 17 - 34967195-34967201:34967204-34967209:34967212-34967221:34967224-34967245:34967253-34967257 ni20c01.s1 NCI_CGAP_Co4 Homo sapiens cDNA clone IMAGE:968544 3, mRNA sequence AA527182

Total number of rows: 48701

Table truncated, full table size 57871 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL13376_HumanWG-6_V2_0_R4_11223189_A.txt.gz 12.0 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap