|
| Status |
Public on Jun 20, 2019 |
| Title |
68KD Pol II |
| Sample type |
SRA |
| |
|
| Source name |
ChIP-seq
|
| Organism |
Homo sapiens |
| Characteristics |
chip antibody: sc-899X
cell line: 293 Flp-In
|
| Growth protocol |
293 cells were maintained in DMEM with 10% fetal bovine serum and antibiotics.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody.
Libraries were prepared using Illumina's TruSeq ChIP library Preparation Kit according to Illumina's instructions.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Adapters were trimmed with Cutadapt v. 1.9.1 with the following parameters: --minimum-length 10 -e 0.05 --times 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 15,10
Alignment was done with Bowtie2 v. 2.2.5 to hg19.
Extraction of properly paired and properly mapped reads and Bam files sorting and indexing were done with SAMtools v. 1.3.1
Mapped reads were de-duplicated with Picard
BigWig files were generated with deepTools2 v.2.2.4 with bamCoverage tool and the following parameters: -bs 10 --normalizeTo1x 2451960000 -e -p max
Genome_build: hg19
Supplementary_files_format_and_content: bigwig files: genome-coverage files for all samples
|
| |
|
| Submission date |
Jun 12, 2017 |
| Last update date |
Jun 21, 2019 |
| Contact name |
Michael Tellier |
| E-mail(s) |
mt477@leicester.ac.uk
|
| Organization name |
University of Leicester
|
| Department |
Department of Molecular and Cell Biology
|
| Lab |
Tellier Lab
|
| Street address |
Lancaster Road
|
| City |
Leicester |
| State/province |
Select State |
| ZIP/Postal code |
LE1 7HB |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE99955 |
Knockdown of CFIm25 or CFIm68 decreases RNA polymerase II pausing and transcription |
|
| Relations |
| BioSample |
SAMN07227821 |
| SRA |
SRX2915408 |
