NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3898202 Query DataSets for GSM3898202
Status Public on Jun 20, 2019
Title CFIm68KD DRB Input
Sample type SRA
 
Source name CFIm68KD DRB
Organism Homo sapiens
Characteristics cell line: 293 Flp-In
treatment: DRB
chip antibody: none
Growth protocol 293 cells were maintained in DMEM with 10% fetal bovine serum and antibiotics.
Extracted molecule genomic DNA
Extraction protocol Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody.
Libraries were prepared using Illumina's TruSeq ChIP library Preparation Kit according to Illumina's instructions.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina HiSeq 4000
 
Data processing Adapters were trimmed with Cutadapt v. 1.9.1 with the following parameters: --minimum-length 10 -e 0.05 --times 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 15,10
Alignment was done with Bowtie2 v. 2.2.5 to hg19.
Extraction of properly paired and properly mapped reads and Bam files sorting and indexing were done with SAMtools v. 1.3.1
Mapped reads were de-duplicated with Picard
BigWig files were generated with deepTools2 v.2.2.4 with bamCoverage tool and the following parameters: -bs 10 --normalizeUsingRPKM -e -p max
Genome_build: hg19
Supplementary_files_format_and_content: bigwig files: genome-coverage files for all samples
 
Submission date Jun 19, 2019
Last update date Jun 20, 2019
Contact name Michael Tellier
E-mail(s) mt477@leicester.ac.uk
Organization name University of Leicester
Department Department of Molecular and Cell Biology
Lab Tellier Lab
Street address Lancaster Road
City Leicester
State/province Select State
ZIP/Postal code LE1 7HB
Country United Kingdom
 
Platform ID GPL20301
Series (1)
GSE99955 Knockdown of CFIm25 or CFIm68 decreases RNA polymerase II pausing and transcription
Relations
BioSample SAMN12096222
SRA SRX6095230

Supplementary file Size Download File type/resource
GSM3898202_Cfi68_DRB_Input.bw 180.8 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap