|
Status |
Public on Jun 20, 2019 |
Title |
CFIm68KD DRB Input |
Sample type |
SRA |
|
|
Source name |
CFIm68KD DRB
|
Organism |
Homo sapiens |
Characteristics |
cell line: 293 Flp-In treatment: DRB chip antibody: none
|
Growth protocol |
293 cells were maintained in DMEM with 10% fetal bovine serum and antibiotics.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody. Libraries were prepared using Illumina's TruSeq ChIP library Preparation Kit according to Illumina's instructions.
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
Illumina HiSeq 4000 |
|
|
Data processing |
Adapters were trimmed with Cutadapt v. 1.9.1 with the following parameters: --minimum-length 10 -e 0.05 --times 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 15,10 Alignment was done with Bowtie2 v. 2.2.5 to hg19. Extraction of properly paired and properly mapped reads and Bam files sorting and indexing were done with SAMtools v. 1.3.1 Mapped reads were de-duplicated with Picard BigWig files were generated with deepTools2 v.2.2.4 with bamCoverage tool and the following parameters: -bs 10 --normalizeUsingRPKM -e -p max Genome_build: hg19 Supplementary_files_format_and_content: bigwig files: genome-coverage files for all samples
|
|
|
Submission date |
Jun 19, 2019 |
Last update date |
Jun 20, 2019 |
Contact name |
Michael Tellier |
E-mail(s) |
mt477@leicester.ac.uk
|
Organization name |
University of Leicester
|
Department |
Department of Molecular and Cell Biology
|
Lab |
Tellier Lab
|
Street address |
Lancaster Road
|
City |
Leicester |
State/province |
Select State |
ZIP/Postal code |
LE1 7HB |
Country |
United Kingdom |
|
|
Platform ID |
GPL20301 |
Series (1) |
GSE99955 |
Knockdown of CFIm25 or CFIm68 decreases RNA polymerase II pausing and transcription |
|
Relations |
BioSample |
SAMN12096222 |
SRA |
SRX6095230 |