miRBase entry: hsa-miR-663a

Mature hsa-miR-663a

Accession MIMAT0003326
Description hsa-miR-663a mature miRNA
Hairpins
Sequence AGGCGGGGCGCCGCGGGACCGC
Evidence experimental
SAGE [1]
Database links
Predicted targets


QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.


StarBase

MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.

Target Gene ID Target Gene Name Number of supporting experiments Number of target-predicting programs Maximum number of target sites Chromosome Target-predicting region start Target-predicting region end Strand

miR2Disease

A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.

Click here for more information and to obtain references for the studies.

Disease Differential expression Experiment Year Study